Ancestral Dinner Party | Digital Paintings | Paternal Lineage | Maternal Lineage

Mexico (San Juanita Cruz)
Maternal Lineage

San Juanita de la Cruz (born in Mexico)
Ancestral line: “Eve” > L1/L0 > L2 > L3 > N > A

All information about Ms. de la Cruz’s ancestral journey below provided by The Genographic Project. See https://genographic.nationalgeographic.com

Ms. de la Cruz’s GENETIC SEQUENCE:

Type: mtDNA
Haplogroup: A

Your Mitochondrial HVR I Sequence 

16051G, 16111T, 16145A, 16222T, 16290T, 16319A, 16362C

ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGT
GCCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATT
ACTGCCAGTCACCATGAATATTGTACGGTACCATAAATACTTAACCACCTG
TAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAG
CAAGTACAGCAATCAACTCTCAACTATCACACATCAACTGCAACTCCAAAG
CCACCCCTCACCCACTAGGATACCAACAAACCTATCCACCCTTAACAGTAC
ATAGTACATAAAACCATTTACCGTACATAGCACATTACAGTCAAATCCCTT
CTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCC
TCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCC
CATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTA
CTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG

Key C Subsitution(transition) C Substitution(transversion) C Insertion _ Deletion

How to Interpret Your Results
At left is displayed the sequence of your mitochondrial genome that was analyzed in the laboratory. Your sequence is compared against the Cambridge Reference Sequence (CRS), which is the standard mitochondrial sequence initially determined by researchers at Cambridge, UK. The differences between your DNA and the CRS are highlighted, and these data allow researchers to reconstruct the migratory paths of your genetic lineage. Substitution (transition): a nucleotide base mutation in which a pyrimidine base (C or T) is exchanged for another pyrimidine, or a purine base (A or G) is replaced with another purine. This is the most common type of single point mutation. Substitution (transversion): a base substitution in which a pyrimidine base (C or T) is exchanged for a purine base (A or G), or vice versa. Insertion: a mutation caused by the insertion of at least one extra nucleotide base in the DNA sequence. Deletion: a mutation caused by the deletion of at least one extra nucleotide base from the DNA sequence.

Ms. de la Cruz’s GENETIC HISTORY:

Your Branch on the Human Family Tree

Your DNA results identify you as belonging to a specific branch of the human family tree called A. Haplogroup A contains the following subgroup: A.

The map above shows the direction that your maternal ancestors took as they set out from their original homeland in East Africa. While humans did travel many different paths during a journey that took tens of thousands of years, the lines above represent the dominant trends in this migration.

Over time, the descendants of your ancestors spread throughout East Asia, with some groups making it as far as the Americas. But before we can take you back in time and tell their stories, we must first understand how modern science makes this analysis possible.

How DNA Can Help

The string of 569 letters shown above is your mitochondrial sequence, with the letters A, C, T, and G representing the four nucleotides—the chemical building blocks of life—that make up your DNA. The numbers at the top of the page refer to the positions in your sequence where informative mutations have occurred in your ancestors, and tell us a great deal about the history of your genetic lineage.

Here’s how it works. Every once in a while a mutation—a random, natural (and usually harmless) change—occurs in the sequence of your mitochondrial DNA. Think of it as a spelling mistake: one of the “letters” in your sequence may change from a C to a T, or from an A to a G.

After one of these mutations occurs in a particular woman, she then passes it on to her daughters, and her daughters’ daughters, and so on. (Mothers also pass on their mitochondrial DNA to their sons, but the sons in turn do not pass it on.)

Geneticists use these markers from people all over the world to construct one giant mitochondrial family tree. As you can imagine, the tree is very complex, but scientists can now determine both the age and geographic spread of each branch to reconstruct the prehistoric movements of our ancestors.

By looking at the mutations that you carry, we can trace your lineage, ancestor by ancestor, to reveal the path they traveled as they moved out of Africa. Our story begins with your earliest ancestor. Who was she, where did she live, and what is her story?

Your Ancestral Journey: What We Know Now

We will now take you back through the stories of your distant ancestors and show how the movements of their descendants gave rise to your mitochondrial lineage.

Each segment on the map above represents the migratory path of successive groups that eventually coalesced to form your branch of the tree. We start with your oldest ancestor, “Eve,” and walk forward to more recent times, showing at each step the line of your ancestors who lived up to that point.

Mitochondrial Eve: The Mother of Us All

Ancestral Line: “Mitochondrial Eve”

Our story begins in Africa sometime between 150,000 and 170,000 years ago, with a woman whom anthropologists have nicknamed “Mitochondrial Eve.”

She was awarded this mythic epithet in 1987 when population geneticists discovered that all people alive on the planet today can trace their maternal lineage back to her.

But Mitochondrial Eve was not the first female human. Homo sapiens evolved in Africa around 200,000 years ago, and the first hominids—characterized by their unique bipedal stature—appeared nearly two million years before that. Though Homo sapiens have been around for about 200,000 years, about 150,000 to 170,000 years ago, a woman was born from whom we are all descended. This happened 30,000 years after Homo sapiens evolved in Africa.

Eventually, for any number of reasons, all of the other lineages of people went extinct, and “Mitochondrial Eve” as we call her, was the only female who had descendants that are now living in the present day. We can all be traced back to that one woman, who lived about 170,000 years ago.

Which begs the question, “So why Eve?”

Simply put, Eve was a survivor. A maternal line can become extinct for a number of reasons. A woman may not have children, or she may bear only sons (who do not pass her mtDNA to the next generation). She may fall victim to a catastrophic event such as a volcanic eruption, flood, or famine, all of which have plagued humans since the dawn of our species.

None of these extinction events happened to Eve’s line. It may have been simple luck, or it may have been something much more. It was around this same time that modern humans’ intellectual capacity underwent what author Jared Diamond coined the Great Leap Forward. Many anthropologists believe that the emergence of language gave us a huge advantage over other early human species. Improved tools and weapons, the ability to plan ahead and cooperate with one another, and an increased capacity to exploit resources in ways we hadn’t been able to earlier, all allowed modern humans to rapidly migrate to new territories, exploit new resources, and outcompete and replace other hominids, such as the Neandertals.

It is difficult to pinpoint the chain of events that led to Eve’s unique success, but we can say with certainty that all of us trace our maternal lineage back to this one woman.

The L Haplogroups: The Deepest Branches

Ancestral line: “Eve” > L1/L0

Mitochondrial Eve represents the root of the human family tree. Her descendents, moving around within Africa, eventually split into two distinct groups, characterized by a different set of mutations their members carry.

These groups are referred to as L0 and L1, and these individuals have the most divergent genetic sequences of anybody alive today, meaning they represent the deepest branches of the mitochondrial tree. Importantly, current genetic data indicates that indigenous people belonging to these groups are found exclusively in Africa. This means that, because all humans have a common female ancestor, “Eve,” and because the genetic data shows that Africans are the oldest groups on the planet, we know our species originated there.

Haplogroups L1 and L0 likely originated in East Africa and then spread throughout the rest of the continent. Today, these lineages are found at highest frequencies in Africa’s indigenous populations, the hunter-gatherer groups who have maintained their ancestors’ culture, language, and customs for thousands of years.

At some point, after these two groups had coexisted in Africa for a few thousand years, something important happened. The mitochondrial sequence of a woman in one of these groups, L1, mutated. A letter in her DNA changed, and because many of her descendants have survived to the present, this change has become a window into the past. The descendants of this woman, characterized by this signpost mutation, went on to form their own group, called L2. Because the ancestor of L2 was herself a member of L1, we can say something about the emergence of these important groups: Eve begat L1,and L1 begat L2. Now we’re starting to move down your ancestral line.

Haplogroup L2: West Africa

Ancestral line: “Eve” > L1/L0 > L2

L2 individuals are found in sub-Saharan Africa, and like their L1 predecessors, they also live in Central Africa and as far south as South Africa. But whereas L1/L0 individuals remained predominantly in eastern and southern Africa, your ancestors broke off into a different direction, which you can follow on the map above.

L2 individuals are most predominant in West Africa, where they constitute the majority of female lineages. And because L2individuals are found at high frequencies and widely distributed along western Africa, they represent one of the predominant lineages in African-Americans. Unfortunately, it is difficult to pinpoint where a specific L2 lineage might have arisen. For an African-American who is L2—the likely result of West Africans being brought to America during the slave trade—it is difficult to say with certainty exactly where in Africa that lineage arose.

Fortunately, collaborative sampling with indigenous groups is currently underway to help learn more about these types of questions and to possibly bridge the gap that was created during those transatlantic voyages hundreds of years ago.

Haplogroup L3: Out of Africa

Ancestral line: “Eve” > L1/L0 > L2 > L3

Your next signpost ancestor is the woman whose birth around 80,000 years ago began haplogroup L3. It is a similar story: an individual in L2 underwent a mutation to her mitochondrial DNA, which was passed onto her children. The children were successful, and their descendants ultimately broke away from the L2 clan, eventually separating into a new group calledL3. You can see above that this has revealed another step in your ancestral line.

While L3 individuals are found all over Africa, including the southern reaches of sub-Sahara, L3 is important for its movements north. You can follow this movement of the map above, seeing first the expansions of L1/L0, then L2, and followed by the northward migration of L3.

Your L3 ancestors were significant because they are the first modern humans to have left Africa, representing the deepest branches of the tree found outside of that continent.

Why would humans have first ventured out of the familiar African hunting grounds and into unexplored lands? It is likely that a fluctuation in climate may have provided the impetus for your ancestors’ exodus out of Africa.

The African Ice Age was characterized by drought rather than by cold. Around 50,000 years ago the ice sheets of northern Europe began to melt, introducing a period of warmer temperatures and moister climate in Africa. Parts of the inhospitable Sahara briefly became habitable. As the drought-ridden desert changed to savanna, the animals your ancestors hunted expanded their range and began moving through the newly emerging green corridor of grasslands. Your nomadic ancestors followed the good weather and plentiful game northward across this Saharan Gateway, although the exact route they followed remains to be determined.

Today, L3 individuals are found at high frequencies in populations across North Africa. From there, members of this group went in a few different directions. Some lineages within L3 testify to a distinct expansion event in the mid-Holocene that headed south, and are predominant in many Bantu groups found all over Africa. One group of individuals headed west and is primarily restricted to Atlantic western Africa, including the islands of Cabo Verde.

Other L3 individuals, your ancestors, kept moving northward, eventually leaving the African continent completely. These people currently make up around ten percent of the Middle Eastern population, and gave rise to two important haplogroups that went on to populate the rest of the world.

Haplogroup N: The Incubation Period

Ancestral line: “Eve” > L1/L0 > L2 > L3 > N

Your next signpost ancestor is the woman whose descendants formed haplogroup N. Haplogroup N comprises one of two groups that were created by the descendants of L3.

The first of these groups, M, was the result of the first great wave of migration of modern humans to leave Africa. These people likely left the continent across the Horn of Africa near Ethiopia, and their descendants followed a coastal route eastward, eventually making it all the way to Australia and Polynesia.

The second great wave, also of L3 individuals, moved north rather than east and left the African continent across the Sinai Peninsula, in present-day Egypt. Also faced with the harsh desert conditions of the Sahara, these people likely followed the Nile basin, which would have proved a reliable water and food supply in spite of the surrounding desert and its frequent sandstorms.

Descendants of these migrants eventually formed haplogroup N. Early members of this group lived in the eastern Mediterranean region and western Asia, where they likely coexisted for a time with other hominids such as Neandertals. Excavations in Israel’s Kebara Cave (Mount Carmel) have unearthed Neandertal skeletons as recent as 60,000 years old, indicating that there was both geographic and temporal overlap of these two hominids.

Some members bearing mutations specific to haplogroup N formed many groups of their own which went on to populate much of the rest of the globe. These descendants are found throughout Asia, Europe, India, and the Americas. However, because almost all of the mitochondrial lineages found in the Near East and Europe descend from N, it is considered a western Eurasian haplogroup.

After several thousand years in the Near East, members of your group began moving into unexplored nearby territories, following large herds of migrating game across vast plains. These groups broke into several directions and made their way into territories surrounding the Near East. Today, haplogroup N individuals who headed west are prevalent in Turkey and the eastern Mediterranean, they are found further east in parts of Central Asia and the Indus Valley of Pakistan and India. Descendants of these people eventually went on to populate the rest of Europe, and today comprise the most frequent mitochondrial lineages found there.

Haplogroup A: Your Branch on the Tree

Ancestral line: “Eve” > L1/L0 > L2 > L3 > N > A

One group of these early N individuals broke away in the Central Asian steppes and set out on their own journey following herds of game across vast expanses. Around 50,000 years ago, the first members of your haplogroup A began moving east across Siberia, the beginnings of a journey that did not stop until finally reaching both continents of the Americas.

Your haplogroup likely arose on the high plains of Central Asia between the Caspian Sea and Lake Baikal. Groups moving east brought haplogroup A with them, and it was spread to several different areas in East Asia. One recent subgroup, known as A5, arose around 10,000 years ago and today is specific to Korean and Japanese populations. Another subgroup, A4, is widely spread and found in ten percent of Chinese, and at lower frequencies (one to five percent) in Southeast Asia, Central Asia, and Siberia.

Haplogroup A was first found among aboriginal American populations and has played an important role in allowing geneticists to use DNA mutations as an evolutionary clock to date prehistoric migrations.

With few exceptions, haplogroup A is the only lineage carried by Eskimos, an indigenous group native to Siberia, Alaska, and Canada. Because a reliable date of around 11,000 years ago has been assigned to their colonization of these territories, DNA mutations specific to the Eskimo have allowed geneticists to use their age to infer a molecular clock for human mutations. It has enabled geneticists to place accurate age estimates not only on the Eskimos and the peopling of the Americas, but on prehistoric human migrations throughout the world.

In northern Eurasia and Siberia, haplogroup A individuals with experience surviving the harsh Central and East Asian winters would have been ideally suited for the arduous crossing of the recently formed Bering land bridge. During the last glacial maximum, 15,000 to 20,000 years ago, colder temperatures and a drier global climate locked much of the world’s fresh water at the polar ice caps, making living conditions near impossible for much of the northern hemisphere. But an important result of this glaciation was that eastern Siberia and northwestern Alaska became temporarily connected by a vast ice sheet. Haplogroup A-bearing individuals, fishing along the coastline, followed it.

Today, haplogroup A is one of five mitochondrial lineages found in aboriginal Americans, and is found in both North and South America. While haplogroup A is very old (around 50,000 years), the reduced genetic diversity found in the Americas indicates that those lineages arrived only within the last 15,000 to 20,000 years and quickly spread once there. Better understanding exactly how many waves of humans crossed into the Americas, and where they migrated to once there, remains the focus of much interest and is central to Genographic’s ongoing research in the Americas.

Anthropology vs. Genealogy

DNA markers require a long time to become informative. While mutations occur in every generation, it requires at least hundreds—normally thousands—of years for these markers to become windows back into the past, signposts on the human tree.

Still, our own genetic sequences often reveal that we fall within a particular sub-branch, a smaller, more recent branch on the tree.

While it may be difficult to say anything about the history of these sub-groups, they do reveal other people who are more closely related to us. It is a useful way to help bridge the anthropology of population genetics with the genealogy to which we are all accustomed.

One of the ways you can bridge this gap is to compare your own genetic lineage to those of people living all over the world. Mitosearch.org is a database that allows you to compare both your genetic sequence as well as your surname to those of thousands of people who have already joined the database. This type of search is a valuable way of inferring population events that have occurred in more recent times (i.e., the past few hundred years).

Looking Forward (Into the Past): Where Do We Go From Here?

Although the arrow of your haplogroup currently ends in the Americas, this is not the end of the journey for haplogroup A. This is where the genetic clues get murky and your DNA trail goes cold. Your initial results shown here are based upon the best information available today—but this is just the beginning.

A fundamental goal of the Genographic Project is to extend these arrows further toward the present day. To do this, Genographic has brought together ten renowned scientists and their teams from all over the world to study questions vital to our understanding of human history. By working together with indigenous peoples around the globe, we are learning more about these ancient migrations.