Ancestral Dinner Party | Digital Paintings | Paternal Lineage | Maternal Lineage

Cuba (Neri Torres)
Maternal Lineage

Neri Torres (born in Cuba)
Ancestral line: “Eve” > L1/L0 > L2

All information about Mr. Torres’s ancestral journey below provided by The Genographic Project. See https://genographic.nationalgeographic.com

Ms. Torres’ GENETIC SEQUENCE:

Type: mtDNA
Haplogroup: L2 (Subclade L2d)

Your Mitochondrial HVR I Sequence

16111A, 16145A, 16184T, 16189C, 16223T, 16278T, 16292T, 16298C, 16355T, 16390A, 16399G, 16400T, 16519C

ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTA
CCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATT
ACTGCCAGACACCATGAATATTGTACGGTACCATAAATACTTAACCACCTG
TAGTACATAAAAACCCAATCCACATCAAAATCCCCCCCCCATGCTTACAAG
CAAGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAG
CCACCCCTCACCCACTAGGATATCAACAAACCTACCTACCCTCAACAGTAC
ATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCTTT
CTCGTCCCCATGGATGACCCCCCTCAGATAGGAGTCCCTTGGTCACCATCC
TCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCC
CATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTA
CTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACA
TCACGATG

Key C Subsitution(transition) C Substitution(transversion) C Insertion _ Deletion

How to Interpret Your Results
At left is displayed the sequence of your mitochondrial genome that was analyzed in the laboratory. Your sequence is compared against the Cambridge Reference Sequence (CRS), which is the standard mitochondrial sequence initially determined by researchers at Cambridge, UK. The differences between your DNA and the CRS are highlighted, and these data allow researchers to reconstruct the migratory paths of your genetic lineage. Substitution (transition): a nucleotide base mutation in which a pyrimidine base (C or T) is exchanged for another pyrimidine, or a purine base (A or G) is replaced with another purine. This is the most common type of single point mutation. Substitution (transversion): a base substitution in which a pyrimidine base (C or T) is exchanged for a purine base (A or G), or vice versa. Insertion: a mutation caused by the insertion of at least one extra nucleotide base in the DNA sequence. Deletion: a mutation caused by the deletion of at least one extra nucleotide base from the DNA sequence.

Ms. Torres’ GENETIC HISTORY:

Your Branch on the Human Family Tree

Your DNA results identify you as belonging to a specific branch of the human family tree called haplogroup L2. Haplogroup L2 contains the following subgroups: L2, L2a.

The map above shows the direction that your maternal ancestors took as they set out from their original homeland in East Africa. While humans did travel many different paths during a journey that took tens of thousands of years, the lines above represent the dominant trends in this migration.

Over time, the descendants of your ancestors made their way all over Africa and particularly into West Africa, where their lineages are most common. But before we can take you back in time and tell their stories, we must first understand how modern science makes this analysis possible.

How DNA Can Help

The string of 569 letters shown above is your mitochondrial sequence, with the letters A, C, T, and G representing the four nucleotides—the chemical building blocks of life—that make up your DNA. The numbers at the top of the page refer to the positions in your sequence where informative mutations have occurred in your ancestors, and tell us a great deal about the history of your genetic lineage.

Here’s how it works. Every once in a while a mutation—a random, natural (and usually harmless) change—occurs in the sequence of your mitochondrial DNA. Think of it as a spelling mistake: one of the “letters” in your sequence may change from a C to a T, or from an A to a G.

After one of these mutations occurs in a particular woman, she then passes it on to her daughters, and her daughters’ daughters, and so on. (Mothers also pass on their mitochondrial DNA to their sons, but the sons in turn do not pass it on.)

Geneticists use these markers from people all over the world to construct one giant mitochondrial family tree. As you can imagine, the tree is very complex, but scientists can now determine both the age and geographic spread of each branch to reconstruct the prehistoric movements of our ancestors.

By looking at the mutations that you carry, we can trace your lineage, ancestor by ancestor, to reveal the path they traveled as they moved out of Africa. Our story begins with your earliest ancestor. Who was she, where did she live, and what is her story?

Your Ancestral Journey: What We Know Now

We will now take you back through the stories of your distant ancestors and show how the movements of their descendants gave rise to your mitochondrial lineage.

Each segment on the map above represents the migratory path of successive groups that eventually coalesced to form your branch of the tree. We start with your oldest ancestor, “Eve,” and walk forward to more recent times, showing at each step the line of your ancestors who lived up to that point.

Mitochondrial Eve: The Mother of Us All

Ancestral Line: “Mitochondrial Eve”

Our story begins in Africa sometime between 150,000 and 170,000 years ago, with a woman whom anthropologists have nicknamed “Mitochondrial Eve.”

She was awarded this mythic epithet in 1987 when population geneticists discovered that all people alive on the planet today can trace their maternal lineage back to her.

But Mitochondrial Eve was not the first female human. Homo sapiens evolved in Africa around 200,000 years ago, and the first hominids—characterized by their unique bipedal stature—appeared nearly two million years before that. Yet despite humans having been around for almost 30,000 years, Eve is exceptional because hers is the only lineage from that distant time to survive to the present day.

Which begs the question, “So why Eve?”

Simply put, Eve was a survivor. A maternal line can become extinct for a number of reasons. A woman may not have children, or she may bear only sons (who do not pass her mtDNA to the next generation). She may fall victim to a catastrophic event such as a volcanic eruption, flood, or famine, all of which have plagued humans since the dawn of our species.

None of these extinction events happened to Eve’s line. It may have been simple luck, or it may have been something much more. It was around this same time that modern humans’ intellectual capacity underwent what Jared Diamond coined the Great Leap Forward. Many anthropologists believe that the emergence of language gave us a huge advantage over other early human species. Improved tools and weapons, the ability to plan ahead and cooperate with one another, and an increased capacity to exploit resources in ways we hadn’t been able to earlier, all allowed modern humans to rapidly migrate to new territories, exploit new resources, and outcompete and replace other hominids, such as the Neandertals.

It is difficult to pinpoint the chain of events that led to Eve’s unique success, but we can say with certainty that all of us trace our maternal lineage back to this one woman.

The L Haplogroups: The Deepest Branches

Ancestral line: “Eve” > L1/L0

Mitochondrial Eve represents the root of the human family tree. Her descendents, moving around within Africa, eventually split into two distinct groups, characterized by a different set of mutations their members carry.

These groups are referred to as L0 and L1, and these individuals have the most divergent genetic sequences of anybody alive today, meaning they represent the deepest branches of the mitochondrial tree. Importantly, current genetic data indicates that indigenous people belonging to these groups are found exclusively in Africa. This means that, because all humans have a common female ancestor, “Eve,” and because the genetic data shows that Africans are the oldest groups on the planet, we know our species originated there.

Haplogroups L1 and L0 likely originated in East Africa and then spread throughout the rest of the continent. Today, these lineages are found at highest frequencies in Africa’s indigenous populations, the hunter-gatherer groups who have maintained their ancestors’ culture, language, and customs for thousands of years.

At some point, after these two groups had coexisted in Africa for a few thousand years, something important happened. The mitochondrial sequence of a woman in one of these groups, L1, mutated. A letter in her DNA changed, and because many of her descendants have survived to the present, this change has become a window into the past. The descendants of this woman, characterized by this signpost mutation, went on to form their own group, called L2. Because the ancestor of L2 was herself a member of L1, we can say something about the emergence of these important groups: Eve begat L1,and L1 begat L2. Now we’re starting to move down your ancestral line.

Haplogroup L2: West Africa

Ancestral line: “Eve” > L1/L0 > L2

L2 individuals are found in sub-Saharan Africa, and like their L1 predecessors, they also live in Central Africa and as far south as South Africa. But whereas L1/L0 individuals remained predominantly in eastern and southern Africa, your ancestors broke off into a different direction, which you can follow on the map above.

But why would humans have first ventured out of their familiar African hunting grounds and into unexplored lands? It is likely that a fluctuation in climate may have provided the impetus for your ancestors’ movements.

The African Ice Age was characterized by drought rather than by cold. Around 50,000 years ago the ice sheets of northern Europe began to melt, introducing a period of warmer temperatures and moister climate in Africa. Parts of the inhospitable Sahara briefly became habitable. As the drought-ridden desert changed to savanna, the animals your ancestors hunted expanded their range and began moving through the newly emerging green corridor of grasslands. Your nomadic ancestors followed the good weather and plentiful game north and west across this Saharan Gateway, although the exact route they followed remains to be determined.

L2 individuals are the most frequent and widespread mtDNA haplogroup in Africa. The haplogroup can be separated into four unique subsets (L2a, b, c, and d), based on genetic signatures particular to each. L2a shows a wide distribution and is found at high frequencies in southeast Africa. However, L2b, L2c, and L2d individuals are largely confined to West and western Central Africa. L2d individuals are the oldest group, with L2b and L2c individuals splitting off most recently. It is therefore likely that the L2 group, which arose around 70,000 years ago from a single female ancestor, first emerged in West and west-central Africa.

L2 is considered the signature Bantu haplogroup, accounting for around half of the genetic lineages found in the southeast African Bantu populations. The great Bantu migrations of the first millennium B.C. brought the Iron Age from West Africa to the rest of the continent, and in the process it is likely that many of the original L0 and L1 individuals living there were either assimilated or displaced. This helps explain why these more recent L2 lineages, descendants of L1, are found at high frequencies in many parts of Central and East Africa despite having arisen elsewhere.

Because of their geographic spread, particularly throughout West Africa, L2 is also the most predominant African-American mitochondrial lineage, found at around 20 percent in the Americas. While some American lineages are shared with eastern and southeastern Africans, they are not shared uniquely; the lineages are also present in West Africa. Unfortunately, the wide distribution of L2 in Africa makes identifying the geographical origins of the lineages difficult. Put a different way, for an African-American who is L2—the likely result of West Africans being brought to America during the Atlantic slave trade—it is difficult to say with certainty exactly where in Africa that lineage arose.

Fortunately, collaborative sampling with indigenous groups is currently underway to help learn more about these origins. With more genetic information from Africa, our anthropologists may be able to untangle the complex L2 landscape and begin pinpointing the origins of specific lineages. Our goal is to bridge the gap that was created during those transatlantic voyages hundreds of years ago.

Anthropology vs. Genealogy

DNA markers require a long time to become informative. While mutations occur in every generation, it requires at least hundreds—normally thousands—of years for these markers to become windows back into the past, signposts on the human tree.

Still, our own genetic sequences often reveal that we fall within a particular sub-branch, a smaller, more recent branch on the tree.

While it may be difficult to say anything about the history of these sub-groups, they do reveal other people who are more closely related to us. It is a useful way to help bridge the anthropology of population genetics with the genealogy to which we are all accustomed.

One of the ways you can bridge this gap is to compare your own genetic lineage to those of people living all over the world. Mitosearch.org is a database that allows you to compare both your genetic sequence as well as your surname to those of thousands of people who have already joined the database. This type of search is a valuable way of inferring population events that have occurred in more recent times (i.e., the past few hundred years).

Looking Forward (Into the Past): Where Do We Go From Here?

Although the arrow of your haplogroup currently ends across sub-Saharan Africa, this isn’t the end of the journey for haplogroup L2. This is where the genetic clues get murky and your DNA trail goes cold. Your initial results shown here are based upon the best information available today—but this is just the beginning.

A fundamental goal of the Genographic Project is to extend these arrows further toward the present day. To do this, Genographic has brought together ten renowned scientists and their teams from all over the world to study questions vital to our understanding of human history. By working together with indigenous peoples around the globe, we are learning more about these ancient migrations.